I'm trying to get Japanese input (fcitx5-mozc) set up. I can switch between eng and kana with CTRL+Space, but for some reason the inputs are mapped in a really weird way that makes typing a coherent message basically impossible. For example, typing "aiueo" while in mozc is supposed to output "あいうえお", but instead it gives me "ちにないら" (chi-ni-na-i-ra). My number keys are also mapped to seemingly random hiragana characters ("1234567890" = "ぬふあうえおやゆよわ"), although the numpad gives normal numeric output as long as Number Lock is enabled.

edit: I forgot to mention, but when switching mozc to Direct mode (english characters), it also gives expected outputs. Only the hiragana/katakana give me problems.

I'm running Kubuntu 24.04.3 LTS on an Asus Vivobook (X1704ZA_X1704ZA) with KDE Plasma 5.27.12. Mozc's layout is the default English (US). I tried changing it to Japanese, but there was no visible effect. Mozc Setup also has a few "keymap style" options (MS-IME by default, plus ATOK and Kotoeri), but changing those also seems to have no effect. Has anyone else had this issue?

Since I upgraded to the latest version of Ubuntu 25.10, it keeps freezing. My CPU gets overloaded, as you can see in the picture I had to take from my phone, because there is no way I can take a printscreen phone camera shot. My PC is an Ouvis S1 with 16GB RAM and storage of 1TB. Can anyone help me?

I am running:

@ub-20-04:~$ uname -a

Linux ub-20-04 6.8.0-90-generic #91-Ubuntu SMP PREEMPT_DYNAMIC Tue Nov 18 14:14:30 UTC 2025 x86_64 x86_64 x86_64 GNU/Linux

Trying to upgrade to 25.04 LTS

The upgrade failed, and thankfully reverted back to what I had. Where can I find the details necessary to request help figuring out how to make the upgrade succeed? I started from the dialog asking if I wanted to upgrade to the newer release.

I know I'm not giving much to work with, please guide me to find more details to assist.

Thank you

I had been trying to enable sudo-less use of the mount/umount commands so that I can do this with my regular user during backup jobs, going to a TerraMaster DAS via USB. I like to unmount the drive when it's not in use being backed up to.

I had added this line to my /etc/fstab :

/dev/disk/by-uuid/<my drive's UUID> /mnt/e4TB01/ ext4 noauto,user,owner 0 0

My regular user is the owner of that directory and has rwx. This did not succeed in allowing me to do:

mount -l UUID="my drive's UUID" /mnt/e4TB01/

I get the same error that "mount" requires sudo. However, I did notice that this works:

udisksctl mount --block-device /dev/disk/by-uuid/<my drive's UUID>

...and best of all it "Mounted /dev/sde1 at /mnt/e4TB01/".

This is great, however when reading the manual for udiskctl, all I can find is that it would normally mount this into /media/<my user>/. But in this case, it clearly knew to mount into /mnt/e4TB01. I wonder if it is because I have previously mounted that drive into that directory, so there's some tattoo'd history of that being copied/repeated, or is it because my entry in fstab has helped.

Just curious, anybody know which it is?

When running programs in the standard gnome-terminal, they do not use the whole space, so there are these quite big stripes at the bottom and right (colored like my terminal).

See this picture:

Has anyone had the same problem and managed to fix it?

I installed samba and smbclient on Ubuntu 24.04.3 running on several networked PC. Folder sharing worked fine with an older Ubuntu 22.04.5, but stopped when it was upgraded to 24.04.3. On each system, Downloads folder has sharing enabled with unrestricted access, using Nautilus. Despite seeing:

paul@desktop:~$ sudo smbstatus --shares

Service      pid     Machine       Connected at                     Encryption   Signing     
---------------------------------------------------------------------------------------------
downloads    2147    192.168.0.20  Mon Dec 29 05:53:27 AM 2025 MST  -            -           
IPC$         3468    nuc-intel     Mon Dec 29 05:54:01 AM 2025 MST  -            -           
downloads    2222    192.168.0.9   Mon Dec 29 05:53:27 AM 2025 MST  -            -           

and

paul@desktop:~$ testparm /etc/samba/smb.conf
Load smb config files from /etc/samba/smb.conf
Loaded services file OK.
Weak crypto is allowed by GnuTLS (e.g. NTLM as a compatibility fallback)

Server role: ROLE_STANDALONE

Press enter to see a dump of your service definitions

# Global parameters
[global]
    log file = /var/log/samba/log.%m
    logging = file
    map to guest = Bad User
    max log size = 1000
    obey pam restrictions = Yes
    pam password change = Yes
    panic action = /usr/share/samba/panic-action %d
    passwd chat = *Enter\snew\s*\spassword:* %n\n *Retype\snew\s*\spassword:* %n\n *password\supdated\ssuccessfully* .
    passwd program = /usr/bin/passwd %u
    server role = standalone server
    server string = %h server (Samba, Ubuntu)
    unix password sync = Yes
    usershare allow guests = Yes
    idmap config * : backend = tdb


[printers]
    browseable = No
    comment = All Printers
    create mask = 0700
    path = /var/tmp
    printable = Yes


[print$]
    comment = Printer Drivers
    path = /var/lib/samba/printers


[downloads]
    create mask = 0777
    directory mask = 0777
    guest ok = Yes
    path = /home/paul/Downloads
    read only = No

on desktop PC and:

paul@nuc-intel:~$ sudo smbstatus --shares

Service      pid     Machine       Connected at                     Encryption   Signing     
---------------------------------------------------------------------------------------------
IPC$         1467002 desktop       Mon Dec 29 06:01:10 AM 2025 MST  -            -           

on nuc-intel PC (192.168.0.20) and 192.168.0.9 one.

The folders are not accessible in Nautilus. I'm getting neither anonymous (guest) nor password protected access on 192.168.0.9 system or a weird icon, which Nautilus tries and fails to open in text editor:

I've read a few tutorials about setting up samba, but still don't have a solution for this problem. Is using NFS with Nautilus less problematic? I can live without Windows compatibility.

The other day I installed Ubuntu on my laptop and immediately noticed that when I press any key after a couple of seconds Ubuntu outputs the key I pressed.

My pc is an acemagic x16 pro.

thank you all.

I just installed Ubuntu 24.04.3 and several applications including samba. I don't see a Local Network Share option when I right-click on a folder in Nautilus. What else is needed to get it? I had it working on older version of Ubuntu.

Just updated ubuntu to 24.04 on my Lenovo T400. Before that, suspend always worked.

kernel: 6.8.0-90-generic

cpu: Intel(R) Core(TM)2 Duo CPU P8600 @ 2.40GHz

With the new version, suspend works fine for a while, but after 4–5 wakeups the laptop no longer resumes from sleep.

I’ve read many reports about suspend issues, but none of the suggested solutions worked for me. Most posts say that the latest kernel version (around 6.8.0-50) fixes the problem, but that hasn’t been the case for me.

Can you help me figure out what’s happening?

If I want to install and run two or more Linux OS (only) comprising Ubuntu, Linux Mint and Parrot OS, then what should be the sequence for installation i.e., which OS to install first and which goes last in the installation sequence, on the same HDD.

Also, how should /boot and /boot/efi be configured as, and if I am not wrong, Parrot OS is different from the other two as far as installation requirements are considered?

Is there a way to move all the Wine operations from my HDD drive (where my Linux distro is located and has very little space) to my SSD drive (where everything else is located and has more than enough space)? I need Wine to run programs for files that are located on my SSD, and I can't seem to find a way to find those files through Wine as it is.

i use Ubuntu 22.04. Last week, I accepted the offered updates which included kernel update from vmlinuz-5.15.0-153 to vmlinuz-5.15.0-164. When I restarted the computer (which I do very seldom, because I normally just suspend it), it wouldn't boot. It showed some error messages, then the screen went black and stayed like that.

After some digging for info on the internet, I booted from a flash disk, mounted the internal SSD and found out the kernel had been updated. I edited grub.cfg to use the previous kernel version and the computer started booting again.

Is this a bug? If so, how can I report it?

I have a fasta file with a bunch of sequences that look like this:

>chr_U_5_U_166_U_4:0-19392367:6458748-6462772_0.0
TTTTTTGGCAAATAGCATTCAGCAATTGCGGTGGCCGGCCCATTAAGATACCCCATTAAATGGATACCCTTTCGTGGCTCTGGCCACCTGCTAGTGTTTTATAGTTGTTTTTTCGGAACTTCAGAGCACTGAAAATGCCCCCCAATAAACGGCAACGGT
>chr_U_5_U_166_U_4:0-19392367:6462910-6469516_0.0
AGCGAAAGAAACTACGGTTCGGTGATTTGGAGGCTCCCGACCTGCAAGACACATTATTACCACGCATTTCAAGTTCAAATAAAAAGCCCCGTTTCGAGCTAATTTCAAAACTGCTTCTCCAACACTACGTCCAATAAATCCAATAAAAAGCAATACAC
>chr_U_5_U_166_U_4:0-19392367:6469619-6513042_0.0
GGGCCGACGGGGGGTGACTCCCCTAGCCTGCGACTATTTGGGACACGGAGTTGGTGCGTCTGCGCTTGGTGATTTGCTTCCAAAGGCGGCGATTCAGCGATGGCTTGTCCTGCATTCGAAATAGTTGTTACGCGATTGAAAGCCTTTGGGAATTGGAT

The sequence is all on one line.

I have another file that looks like this:

>chr_U_5_U_166_U_4:0-19392367:6462910-6469516_0.0 
>chr_U_5_U_166_U_4:0-19392367:6469619-6513042_0.0

I want the output to look like this:

>chr_U_5_U_166_U_4:0-19392367:6458748-6462772_0.0
TTTTTTGGCAAATAGCATTCAGCAATTGCGGTGGCCGGCCCATTAAGATACCCCATTAAATGGATACCCTTTCGTGGCTCTGGCCACCTGCTAGTGTTTTATAGTTGTTTTTTCGGAACTTCAGAGCACTGAAAATGCCCCCCAATAAACGGCAACGGT

So basically I want to remove everything that is listed in the file, as well as the line following it. Its working ok if I use a single pattern on the command line, but if I use the file it does not work.

This is what i have been trying:

grep -A1 -F -x -v -f file1.txt file2.txt

Any input would be appreciated.

Posting this here because I spent several hours trying to find the solution and found it here: https://forums.linuxmint.com/viewtopic.php?f=48&t=389383#CS8409

It walks you through the process of creating a driver for linux from the windows driver created by an Open Source someone making the world better for Open Source. :)

Specifically this is what worked for me:

Install git: sudo apt install git

Install other packages (some of these may already be on your install): apt install wget make gcc linux-headers-generic

Clone the driver code: git clone https://github.com/davidjo/snd_hda_macbookpro.git

Switch to the directory so you can compile the code: cd snd_hda_macbookpro/

Run: sudo ./install.cirrus.driver.sh

Reboot the computer.

I have a new system with Intel i9 processor and 32GB of SRAM. OS: Ubuntu with kernel 6.8.0-45. The old system is broken.

For wy work I need to use vmware workstation and with this OS I had to install the version 17.6.

I found that this version of vmware is incompatible with the kernel and as soon as the vm starts the system becomes corrupt: the network doesn't work, the terminal doesn't work, it is impossible to open any type of application. So I have to kill the system manually because it is also impossible to do the shutdown (after one night it is still waiting for the shutdown).

Here are the picture of the main error I see: Error during work During the shutdown I see the errors shown in the following pictures:

If the vmware is not working everything works well. I tried to downgrade the kernel to the 6.8.0-40 (someone says that it can work with vmware), but it seems that there are incompatibilities and at the boot the system goes in recovery mode

I saw that for the vmware version 17.5.1 someone found a patch, so I would like to know if that patch could work also for the 17.6 version.

In any case, anbody knows if there is a solution to be able to use Ubuntu 24.04 with vmware 17.6?

Thanks Claudio

So I'm running a new Ubuntu 24.04 machine at work and we have this system for using RDP to get into windows machines. The system they have setup gives me no ability to control the port at which RDP connection takes place and is autoset to 3389 as default.

I setup Desktop sharing via the Gnome system settings and on 24.04 it's set to 3390 and I can't change it to 3389. How do I change this port on my Ubuntu machine as I can't change anything on the departments RDP system?

P.S. I saw other users ask similar questions but all their solutions involved modifying it on the RDP client side which I can't change.

I upgraded from Ubuntu 23.10 to Ubuntu 24.04 LTS Software boutique is not starting at all. Solution is not working:

1. I removed it: sudo snap remove software-boutique

2. I reinstalled: sudo snap install software-boutique --classic

3. Then started: software-boutique --classic

Traceback (most recent call last):

  File "/snap/ubuntu-mate-welcome/726/usr/bin/ubuntu-mate-welcome", line 30, in <module>
    gi.require_version("WebKit2", "4.0")
  File "/usr/lib/python3/dist-packages/gi/__init__.py", line 125, in require_version
    raise ValueError('Namespace %s not available for version %s' %
ValueError: Namespace WebKit2 not available for version 4.0

sudo apt-get install webkit2gtk-4.1 did not help.

I've always installed kubernetes with sudo apt install -y kubectl kubeadm kubelet. This now gives the message

No apt package "kubeadm", but there is a snap with that name.
Try "snap install kubeadm"


No apt package "kubectl", but there is a snap with that name.
Try "snap install kubectl"


No apt package "kubelet", but there is a snap with that name.
Try "snap install kubelet"

Now if I do

sudo snap install kubectl --classic
sudo snap install kubeadm --classic
sudo snap install kubelet --classic

I get

[init] Using Kubernetes version: v1.27.1
[preflight] Running pre-flight checks
W0517 14:44:01.250068 1034876 checks.go:1064] [preflight] WARNING: Couldn't create the interface used for talking to the container runtime: crictl is required by the container runtime: executable file not found in $PATH
    [WARNING FileExisting-ethtool]: ethtool not found in system path
    [WARNING FileExisting-socat]: socat not found in system path
    [WARNING Service-Kubelet]: kubelet service is not enabled, please run 'systemctl enable kubelet.service'

If I do systemctl enable kubelet.service

I get:

Failed to enable unit: Unit file kubelet.service does not exist.

What did Canonical do? They've broken the install for kuberetes.

Does someone have a script that works with whatever Canonical has done? I'm on Ubuntu 20.04.

I'm currently programming an ESP8266 chip through the Arduino IDE. However, I have two versions of the IDE running at once, because I need an older version to upload files to the chip, and the newer version for other features. Whenever I want to test my program, I have to wait for it to compile in the newer IDE, then switch over to the older version to upload all the LittleFS files.

So I'm wondering: Is there a way to automate this process? To upload the files, I have to switch windows and select a menu option. It's a GUI, and there isn't a way to access it from the command line.

I'm running Ubuntu 22.04 LTS.

I am using XDM (Xtreme Download Manager, a file downloader) for many years, specially for YT since it catch and download YT videos directly (without using another website to give DL of YT videos). Recently, I got this error message (in the image below), and I can't download videos directly from YT anymore.

Picture of the XDM error message

How to solve this problem ?

N.B, I have Ubuntu 20.04.5 LTS, and XDM works well and downloads any Direct Link, but it is not the case in YT. I am using a third-party website to give DL of YT videos that will be downloaded then by XDM.

I'm trying to debug a strange issue with my ~/.bash_profile, and I'd like to be able to see if there are any errors / etc printed when it's run. Is there some log or such somewhere that contains the stdout and/or stderr of the login shell process? Thanks!

The error only happens in the very first root login shell, not when re-executed or re-run in other contexts - it has something to do with that particular context / environment. So standard tricks of tee / piping output / etc from an invoking terminal don't work.

I’m trying to print from Libre Office Writer (Version: 6.4.3.2) on Focal. This is the first time I have connected the printer since installing Ubuntu as a dual boot.

As soon as the printer was plugged in it was recognised as MG2550 series. But when I went to print I get an error message saying,

Print Cancelled
Could not start printer. Check your printer configuration.

I have been through the tutorial Printer Canon MG2550 Driver for Ubuntu 20.04 Focal How to Download & Install, which all seems to have gone fine. I now have 2 printers showing ‘mg2550 - series’ and ‘mg2550’, neither of which will print.

The printer’s definitely turned on, and both the PC and the printer have been turned off and on again.

I'm a newbie to ubuntu and was trying to uninstall dash to dock as I don't need it. I uninstalled it using sudo apt remove gnome-shell-extension-ubuntu-dock and the dock still showed up in activities overview. Then I found someone used to sudo apt purge gnome-shell-extension-ubuntu-dock to resolve the issue. I tried, still no luck. And now this big dock shows up in activities overview.

It would also be helpful if somecan can help me get the dock back to normal!

Note: I'm on Ubuntu 20.04

Any Help Would be Appreciated!

I have numerous hard drives that I boot from. I have drives for Windows 7, Windows 8.1, and Windows 10 as well as various versions of Ubuntu. Also other distros of Linux such as Kubuntu and Debian.

I have downloaded and installed Ubuntu 18.04.01 and found it painfully slow. I have tested numerous configurations to get the following numbers.

All tests have been run on the very same computer, except for swapping the drive. I have been using three identical SSDs, all purchased at the same time. I began by wiping two SSDs using Darik's Boot and Nuke (writing zeroes). Then I installed a copy of 16.04 on one and 18.04.1 on the other. The third SSD began with a fresh install of Windows 7 and then added 16.04 to it.

I also ran additional tests booting live copies of 16.04 and 18.04.1 from thumb drives (USB 2).

WiFi turned off, Ethernet cable connected.

Here are my times to boot and shutdown.

Boot times are measured from when I pushed the power button.

Windows 7: 20 seconds to boot the the desktop.

Ubuntu 16.04 from SSD: 23 seconds to boot. 3 seconds to shut down.

Ubuntu 16.04 live from thumb drive: 55 + 23 seconds. (The first time is from power on to the screen prompting if I want to try or install Ubuntu. The second is from clicking "Try Ubuntu" to the desktop.) 5 seconds to shutdown.

Ubuntu 18.04.1 from SSD: 4 minutes 40 seconds to boot. 1 minute 5 seconds to shut down.

Ubuntu 18.04.1 live from thumb drive: 6 minutes 12 seconds + 2 minutes 25 seconds. 35 seconds to shutdown.

As you can see, the performance of 18.04 is unacceptable. I did a presentation last night to some Windows users of setting up their systems to dual boot so they could try Ubuntu, but I found that I had to demonstrate the older version. None of them would have cared to ever try anything with the performance of this new version.

Here's the output from "systemd-analyze blame"

     31.709s plymouth-start.service
     30.298s systemd-backlight@backlight:intel_backlight.service
     20.361s plymouth-quit-wait.service
     20.081s apt-daily.service
      3.045s NetworkManager-wait-online.service
      2.923s snapd.service
      2.419s apparmor.service
      1.610s dev-sda1.device
       862ms fwupd.service
       721ms dev-loop3.device
       720ms dev-loop1.device
       718ms dev-loop2.device
       714ms dev-loop0.device
       704ms dev-loop4.device
       698ms dev-loop5.device
       694ms dev-loop6.device
       565ms udisks2.service
       553ms NetworkManager.service
       482ms networkd-dispatcher.service
       478ms swapfile.swap
       404ms keyboard-setup.service
       382ms systemd-journal-flush.service
       358ms ModemManager.service
       351ms systemd-journald.service
       349ms systemd-udev-trigger.service
       241ms dns-clean.service
       238ms accounts-daemon.service
       231ms plymouth-read-write.service
       229ms console-setup.service
       199ms gpu-manager.service
       193ms avahi-daemon.service
       190ms speech-dispatcher.service
       186ms upower.service
       181ms grub-common.service
       176ms systemd-rfkill.service
       166ms systemd-resolved.service
       160ms snap-gnome\x2dcalculator-180.mount
       157ms apport.service
       155ms systemd-logind.service
       155ms snap-gnome\x2dcharacters-103.mount
       151ms systemd-timesyncd.service
       150ms snap-gnome\x2dsystem\x2dmonitor-51.mount
       146ms snap-gnome\x2dlogs-37.mount
       138ms thermald.service
       135ms pppd-dns.service
       132ms dev-loop7.device
       132ms snap-gnome\x2d3\x2d26\x2d1604-70.mount
       131ms rsyslog.service
       126ms snap-gtk\x2dcommon\x2dthemes-319.mount
       113ms snap-core-4917.mount
       108ms bolt.service
       103ms wpa_supplicant.service
       102ms snapd.seeded.service
       101ms alsa-restore.service
        80ms systemd-modules-load.service
        78ms user@1000.service
        75ms systemd-udevd.service
        71ms polkit.service
        66ms packagekit.service
        63ms gdm.service
        60ms systemd-random-seed.service
        58ms dev-mqueue.mount
        57ms sys-kernel-debug.mount
        54ms dev-hugepages.mount
        54ms kmod-static-nodes.service
        53ms ufw.service
        48ms systemd-remount-fs.service
        47ms snap-core-5145.mount
        46ms systemd-sysctl.service
        45ms systemd-tmpfiles-clean.service
        44ms systemd-tmpfiles-setup-dev.service
        37ms networking.service
        35ms sys-kernel-config.mount
        31ms systemd-tmpfiles-setup.service
        29ms colord.service
        29ms kerneloops.service
        28ms sys-fs-fuse-connections.mount
        19ms systemd-user-sessions.service
        17ms systemd-update-utmp.service
        14ms ureadahead-stop.service
        14ms setvtrgb.service
        10ms systemd-update-utmp-runlevel.service
         8ms rtkit-daemon.service
         6ms systemd-backlight@leds:dell::kbd_backlight.service
         4ms snapd.socket

I am Running Ubuntu 16.04 KDE. See this for specifications.

$ uname -a
  Linux ElMaverick 4.4.0-112-generic #135-Ubuntu SMP Fri Jan 19 11:48:36 UTC 2018 x86_64 x86_64 x86_64 GNU/Linux

$ cat /etc/issue
  Ubuntu 16.04.1 LTS \n \l

After every suspend, When I wake up my laptop, it never connects to any network and have to restart NetworkManager again. So, out of laziness I wrote this script that worked very well.

I then edited my script as suggested by muru here in an answer to question asked 2 weeks ago. When I executed this script, It shows me this error

Job for NetworkManager.service failed because the control process exited with error code. See "systemctl status NetworkManager.service" and "journalctl -xe" for details.

Output of commands suggested in error is as follows :

systemctl status NetworkManager.service

● NetworkManager.service - Network Manager
  Loaded: loaded (/lib/systemd/system/NetworkManager.service; enabled; vendor preset: enabled)
  Active: inactive (dead) (Result: exit-code) since Mon 2018-01-29 10:00:51 IST; 14s ago
  Process: 25388 ExecStart=/usr/sbin/NetworkManager --no-daemon (code=exited, status=1/FAILURE)
  Main PID: 25388 (code=exited, status=1/FAILURE)

  Jan 29 10:00:51 ElMaverick systemd[1]: Failed to start Network Manager.
  Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Unit entered failed state.
  Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Failed with result 'exit-code'.
  Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Service hold-off time over, scheduling restart.
  Jan 29 10:00:51 ElMaverick systemd[1]: Stopped Network Manager.
  Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Start request repeated too quickly.
  Jan 29 10:00:51 ElMaverick systemd[1]: Failed to start Network Manager.

journalctl -xe

-- Defined-By: systemd
-- Support: http://lists.freedesktop.org/mailman/listinfo/systemd-devel
-- 
-- Unit NetworkManager.service has finished shutting down.
Jan 29 10:00:51 ElMaverick systemd[1]: Starting Network Manager...
-- Subject: Unit NetworkManager.service has begun start-up
-- Defined-By: systemd
-- Support: http://lists.freedesktop.org/mailman/listinfo/systemd-devel
-- 
-- Unit NetworkManager.service has begun starting up.
Jan 29 10:00:51 ElMaverick NetworkManager[25388]: NetworkManager is already running (pid 20138)
Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Main process exited, code=exited, status=1/FAILURE
Jan 29 10:00:51 ElMaverick systemd[1]: Failed to start Network Manager.
-- Subject: Unit NetworkManager.service has failed
-- Defined-By: systemd
-- Support: http://lists.freedesktop.org/mailman/listinfo/systemd-devel
-- 
-- Unit NetworkManager.service has failed.
-- 
-- The result is failed.
Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Unit entered failed state.
Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Failed with result 'exit-code'.
Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Service hold-off time over, scheduling restart.
Jan 29 10:00:51 ElMaverick systemd[1]: Stopped Network Manager.
-- Subject: Unit NetworkManager.service has finished shutting down
-- Defined-By: systemd
-- Support: http://lists.freedesktop.org/mailman/listinfo/systemd-devel
-- 
-- Unit NetworkManager.service has finished shutting down.
Jan 29 10:00:51 ElMaverick systemd[1]: NetworkManager.service: Start request repeated too quickly.
Jan 29 10:00:51 ElMaverick systemd[1]: Failed to start Network Manager.
-- Subject: Unit NetworkManager.service has failed
-- Defined-By: systemd
-- Support: http://lists.freedesktop.org/mailman/listinfo/systemd-devel
-- 
-- Unit NetworkManager.service has failed.
-- 
-- The result is failed.
lines 1356-1393/1393 (END)

This Question is somewhat similar, but unfortunately it's unanswered.

Similar Question here suggests changing a parameter in the file

/etc/sysconfig/network-scripts/ifcfg-eth0 from BOOTPROTO=dhcp to BOOTPROTO=none.

But I was unable to find that file on my system. So, I tried this in Root directory

$ ls -R | grep -i "BOOTPROTO"

That returned nothing.

As suggested in the comment by muru, click this to see output commands. I didn't write down here as they are too long.

1. Can anyone tell What is exactly going on and how to solve this ?

2. Also what change in this and this script caused this error ?

File 1 (contain only selected IDs):

AAX50250
AAX50251
AAX50252
AAX50253
AAX50254
AAX50257
AAX50258

File 2 (Contains sequences with the IDs). This is a FASTA file where lines beginning with as > are the sequence ID and the subsequent lines are the sequence itself.

> AAX50250.1 cds:annotated chromosome:ASM1212v1:Chromosome:1:1770:1 gene:CTA_0001.1 gene_biotype:protein_coding transcript_biotype:protein_coding description:hypothetical protein
ATGAGCATCAGGGGAGTAGGAGGCAACGGGAATAGTCGAATCCCTTCTCATAATGGGGAT
GGATCGAATCGCAGAAGTCAAAATACGAAGAATAAAGTTGAAGATCGAGTTCGTTCTCTA
TATTCATCTCGTAGTAACGAAAATAGAGAATCTCCTTATGCAGTAGTAGACGTCAGCTCT
> AAX50251.1 cds:annotated chromosome:ASM1212v1:Chromosome:1915:2187:-1 gene:CTA_0002.1 gene_biotype:protein_coding transcript_biotype:protein_coding description:hypothetical membrane associated protein
ATGCTTTGTAAAGTTTGTAGAGGATTATCTTCTCTTATTGTTGTTCTCGGAGCTATAAAC
ACTGGAATTTTAGGAGTAACAGGGTATAAGGTAAACCTACTTACTCACCTGCTTGGTGAA
GGAACCATGTGGACACAAGCAGCTTATGTAGTAACGGGAATCGCTGGGGTTATGGTCTGC
> AAX50252.1 cds:annotated chromosome:ASM1212v1:Chromosome:2388:2690:1 gene:CTA_0003.1 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:gatC description:glutamyl-tRNA(Gln) amidotransferase subunit C
ATGACAGAGTCATATGTAAACAAAGAAGAAATCATCTCTTTAGCAAAGAATGCTGCATTG
GAGTTGGAAGATGCCCACGTGGAAGAGTTCGTAACATCTATGAATGACGTCATTGCTTTA
ATGCAGGAAGTAATCGCGATAGATATTTCGGATATCATTCTTGAAGCTACAGTGCATCAT
TTCGTTGGTCCAGAGGATCTTAGAGAAGACATGGTGACTTCGGATTTTACTCAAGAAGAA
TAG
> AAX50262.1 cds:annotated chromosome:ASM1212v1:Chromosome:13318:13932:-1 gene:CTA_0013.1 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:ybbP description:hypothetical membrane spanning protein
ATGTTCGTAGGTATAACGTATTACACCACACCTCTGTTGGAGATAGCTTTAATTTGGGTG
GTCCTTAATTATTTGCTAAAGTTTTTCTGGGGAACAGGCGCCATGGACCTCGTCTTTGGC
TTGTTGTCTTTTCTTTGCCTATTTGTTCTAGCAGAAAAACTTCATCTCCCCGTTATTCGC
AATTTGATGCTTCATGTAGTGAATATTGCGGCTATCGTGGTATTTATTATCTTCCAACCA
GAAATTCGCCTTGCTCTCTCTAGGATACGCTTGTGTAGAGAGAAATTTGTCATCAATATG

So now I have to compare File 1 which contains the selected ids with File2 which has n number of sequences. We need to output the sequences associated with the IDs in file 1.

For example, the ID AAX50250 which is in file 1 should return:

>AAX50250.1 cds:annotated chromosome:ASM1212v1:Chromosome:1:1770:1 gene:CTA_0001.1 gene_biotype:protein_coding transcript_biotype:protein_coding description:hypothetical protein
ATGAGCATCAGGGGAGTAGGAGGCAACGGGAATAGTCGAATCCCTTCTCATAATGGGGAT
GGATCGAATCGCAGAAGTCAAAATACGAAGAATAAAGTTGAAGATCGAGTTCGTTCTCTA
TATTCATCTCGTAGTAACGAAAATAGAGAATCTCCTTATGCAGTAGTAGACGTCAGCTCT
ATGATCGAGAGCACCCCAACGAGTGGAGAGACGACAAGAGCTTCGCGTGGAGTATTCAGT
CGTTTCCAAAGAGGTTTAGGACGAGTAGCTGACAAAGTAAGACGAGCTGTTCAGCGTGCG
TGGAGTTCAGTCTCTATAAGAAGATCGTCTGCAACAAGAGCCGCAGAATCCAGATCAAGT

How can I do this?

I'm adding a Network card (OneConnect 10Gb) on Ubuntu 16.04 and run the ethtool command but output shows speed and duplex unknown!.

Any idea how to fix this problem?

xxx:~# ethtool  enp12s0f0
Settings for enp12s0f0:
        Supported ports: [ FIBRE ]
        Supported link modes:   1000baseT/Full
                                10000baseT/Full
        Supported pause frame use: Symmetric
        Supports auto-negotiation: No
        Advertised link modes:  Not reported
        Advertised pause frame use: No
        Advertised auto-negotiation: No
        **Speed: Unknown!
        Duplex: Unknown! (255)**
        Port: FIBRE
        PHYAD: 1
        Transceiver: external
        Auto-negotiation: off
        Supports Wake-on: d
        Wake-on: d
        Current message level: 0x00002000 (8192)
                               hw
        Link detected: no

Ethernet device driver and firmware information:

driver: be2net
version: 10.6.0.3
firmware-version: 4.0.360.3
expansion-rom-version:
bus-info: 0000:0c:00.0
supports-statistics: yes
supports-test: yes
supports-eeprom-access: yes
supports-register-dump: no
supports-priv-flags: no

Detailed vendor information

*-network:0
       description: Ethernet interface
       product: OneConnect 10Gb NIC
       vendor: Emulex Corporation
       physical id: 0
       bus info: pci@0000:0c:00.0
       logical name: enp12s0f0
       version: 02
       serial: 00:00:c9:c2:99:94
       capacity: 1Gbit/s
       width: 64 bits
       clock: 33MHz
       capabilities: pm msix pciexpress bus_master cap_list rom ethernet physical fibre 1000bt-fd
       configuration: autonegotiation=off broadcast=yes driver=be2net driverversion=10.6.0.3 firmware=4.0.360.3 latency=0 link=no multicast=yes port=fibre
       resources: irq:16 memory:fc57c000-fc57ffff memory:fc540000-fc55ffff memory:fc520000-fc53ffff memory:fc300000-fc37ffff

Ethernet card(s) available on your system

03:00.0 Ethernet controller: Broadcom Corporation NetXtreme II BCM5708 Gigabit Ethernet (rev 12)
07:00.0 Ethernet controller: Broadcom Corporation NetXtreme II BCM5708 Gigabit Ethernet (rev 12)
0c:00.0 Ethernet controller: Emulex Corporation OneConnect 10Gb NIC (rev 02)
0c:00.1 Ethernet controller: Emulex Corporation OneConnect 10Gb NIC (rev 02)

Thank You ..

I tried to read some posts regarding mounting a new hard drive, but I am facing some problem. My new hard drive is sda1. The output of sudo fdisk -l is:

sudo fdisk -l

Disk /dev/sdb: 999.7 GB, 999653638144 bytes
255 heads, 63 sectors/track, 121534 cylinders, total 1952448512 sectors
Units = sectors of 1 * 512 = 512 bytes
Sector size (logical/physical): 512 bytes / 512 bytes
I/O size (minimum/optimal): 512 bytes / 512 bytes
Disk identifier: 0x00016485

   Device Boot      Start         End      Blocks   Id  System
/dev/sdb1   *        2048  1935822847   967910400   83  Linux
/dev/sdb2      1935824894  1952446463     8310785    5  Extended
/dev/sdb5      1935824896  1952446463     8310784   82  Linux swap / Solaris

Disk /dev/sda: 1000.2 GB, 1000204886016 bytes
255 heads, 63 sectors/track, 121601 cylinders, total 1953525168 sectors
Units = sectors of 1 * 512 = 512 bytes
Sector size (logical/physical): 512 bytes / 4096 bytes
I/O size (minimum/optimal): 4096 bytes / 4096 bytes
Disk identifier: 0x78dbcdc1

   Device Boot      Start         End      Blocks   Id  System
/dev/sda1            2048  1953521663   976759808    7  HPFS/NTFS/exFAT

What should be done to add this new sda1 hard drive on booting up? What should be added in the /etc/fstab file? I have not performed any partition on the new sda1 drive. I need help on how to proceed from scratch and can't afford to take any risk. Please help!

I am trying to follow the Mobile app development tutorial found here. When I try to run the currency converter in QT Creator I get this error:

Starting external tool '/usr/bin/qmlviewer' ''
qmlviewer: could not exec '/usr/lib/x86_64-linux-gnu/qt5/bin/qmlviewer': No such file or directory

I'm not sure how to fix this? I can run the program from the command line and it runs fine but it doesn't work in Qt Creator. Has any one else had these issues? Any advice on how to fix it?

Triple Booting Xubuntu, Ubuntu and Windows

I'm an avid Xubuntu (Ubuntu + XFCE) user but I also dual boot with Windows XP. I originally created 3 partitions and wanted to use the empty one as a storage volume but now I want to install Ubuntu 12.04 LTS (the one with Unity) to do advanced testing and packaging. Ideally I would love to keep these two totally separate as I had problems in the past with conflicts between Unity and XFCE. This way I could wipe the Ubuntu w/ Unity installation if there are problems and really mess around with it.

My disk looks like this:

Disk /dev/sda: 200.0 GB, 200049647616 bytes
255 heads, 63 sectors/track, 24321 cylinders, total 390721968 sectors
Units = sectors of 1 * 512 = 512 bytes
Sector size (logical/physical): 512 bytes / 512 bytes
I/O size (minimum/optimal): 512 bytes / 512 bytes

   Device Boot      Start         End      Blocks   Id  System
/dev/sda1   *          63    78139454    39069696    7  HPFS/NTFS/exFAT
/dev/sda2        78141440   156280831    39069696   83  Linux
/dev/sda3       156282878   386533375   115125249    5  Extended
/dev/sda4       386533376   390721535     2094080   82  Linux swap / Solaris
/dev/sda5       156282880   386533375   115125248   83  Linux

Keep each in it's own partition and totally separate and be able to select from each of the three systems from the GRUB boot menu...

sda1 ---> [Windows XP]
sda2 ---> [Ubuntu 12.04] "Unity"
sda3(4,5) --> [Xubuntu 12.02] "Primary XFCE"

What is the safest and easiest way to do this without messing my system up and requiring invasive activity?